N - Import data in an N field
-
Open the Import window. For instructions see
Data import.
-
Copy the data (in the format as seen below) to clipboard.
|
Name
|
Sequence
|
|
BIO 14
|
aaaatccgtaggtgaacctgcggaaggatcattagtgaatataggacgtccaacttaacttggagtccgaactctcactttctaaccctgtgcacttgtttgggatagtaactctcgcaagagagcgaactcctattcactt
|
For practicing purposes, copy the following to clipboard:
Name Sequence
BIO 14 aaaatccgtaggtgaacctgcggaaggatcattagtgaatataggacgtccaacttaacttggagtccgaactctcactttctaaccctgtgcacttgtttgggatagtaactctcgcaagagagcgaactcctattcactt
-
In BioloMICS in step 1 of the import wizard, click "Paste tabular data".
-
In step 2, link the field to the corresponding field in the database.
-
In step 3, append or merge the data. For more information about merging data in an N field, click
here.
